ENSDARG00000088672

Ensembl ID:
ENSDARG00000088672
Human Orthologues:
IL1R1, IL1RL1, IL1RL2
Human Descriptions:
interleukin 1 receptor, type I [Source:HGNC Symbol;Acc:5993]
interleukin 1 receptor-like 1 [Source:HGNC Symbol;Acc:5998]
interleukin 1 receptor-like 2 [Source:HGNC Symbol;Acc:5999]
Mouse Orthologues:
Il1r1, Il1rl1, Il1rl2
Mouse Descriptions:
interleukin 1 receptor, type I Gene [Source:MGI Symbol;Acc:MGI:96545]
interleukin 1 receptor-like 1 Gene [Source:MGI Symbol;Acc:MGI:98427]
interleukin 1 receptor-like 2 Gene [Source:MGI Symbol;Acc:MGI:1913107]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8912 Nonsense Mutation detected in F1 DNA During 2014
sa10057 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122155 Nonsense 400 580 9 11
ENSDART00000122155 Nonsense 400 580 9 11
Genomic Location:
Chromosome 9 (position 54845089)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTCTTCACTGTGGTTGTTTTTCCTYTAGATGGCGATGGTAAGCAGTA[T/G]GACGCATATATCGCCTATCCCAGAGTCCTGGAGGGCTCYAGTGAAAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10057
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122155 Nonsense 400 580 9 11
ENSDART00000122155 Nonsense 400 580 9 11
Genomic Location:
Chromosome 9 (position 54845089)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTCTTCACTGTGGTTGTTTTTCCTYTAGATGGCGATGGTAAGCAGTA[T/G]GACGCATATATCGCCTATCCCAGAGTCCTGGAGGGCTCYAGTGAAAAGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Asthma: Genome-wide association studies of asthma in population-based cohorts confirm known and suggested loci and identify an additional association near HLA. (View Study)
  • Asthma: Genome-wide association study to identify genetic determinants of severe asthma. (View Study)
  • Asthma: Meta-analysis of genome-wide association studies of asthma in ethnically diverse North American populations. (View Study)
  • Atopic dermatitis: Genome-wide association study identifies eight new susceptibility loci for atopic dermatitis in the Japanese population. (View Study)
  • Celiac disease: Multiple common variants for celiac disease influencing immune gene expression. (View Study)
  • Celiac disease: Newly identified genetic risk variants for celiac disease related to the immune response. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Eosinophil counts: Sequence variants affecting eosinophil numbers associate with asthma and myocardial infarction. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t7la3hih