lman2lb

Ensembl ID:
ENSDARG00000088663
ZFIN ID:
ZDB-GENE-060929-256
Description:
lectin, mannose-binding 2-like b [Source:RefSeq peptide;Acc:NP_001070201]
Human Orthologue:
LMAN2L
Human Description:
lectin, mannose-binding 2-like [Source:HGNC Symbol;Acc:19263]
Mouse Orthologue:
Lman2l
Mouse Description:
lectin, mannose-binding 2-like Gene [Source:MGI Symbol;Acc:MGI:2443010]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38474 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38474
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126669 Essential Splice Site 175 354 4 8
Genomic Location (Zv9):
Chromosome 5 (position 28534337)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26289635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGGGTATTTTTGTGGACACTTATCCAAACGATGATAAGCAGCACGAG[G/A]TAAATGTGAAACATGAAATTAGTAATATGAAACTACTCTACATATCAGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Genome-wide association study meta-analysis of European and Asian-ancestry samples identifies three novel loci associated with bipolar disorder. (View Study)
  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link