ENSDARG00000088660

Ensembl ID:
ENSDARG00000088660
Human Orthologues:
EFEMP1, EFEMP2, FBLN5
Human Descriptions:
EGF-containing fibulin-like extracellular matrix protein 1 [Source:HGNC Symbol;Acc:3218]
EGF-containing fibulin-like extracellular matrix protein 2 [Source:HGNC Symbol;Acc:3219]
fibulin 5 [Source:HGNC Symbol;Acc:3602]
Mouse Orthologues:
Efemp1, Efemp2, Fbln5
Mouse Descriptions:
epidermal growth factor-containing fibulin-like extracellular matrix protein 1 Gene [Source:MGI Symb
epidermal growth factor-containing fibulin-like extracellular matrix protein 2 Gene [Source:MGI Symb
fibulin 5 Gene [Source:MGI Symbol;Acc:MGI:1346091]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7976 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24063 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7976
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125020 Essential Splice Site 95 193 2 4
Genomic Location:
Chromosome 22 (position 4171495)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATGCCCCGCGGGTCACCGACAGAGTGAGACCAACCAGAAGTGTGAAGG[T/C]AYGTCATTCACCACACACACACACACACACACACACACACAGGAGAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24063
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125020 Nonsense 147 193 4 4
Genomic Location:
Chromosome 22 (position 4162761)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGTTGTGTTTCGCACAGATCATCGGATCGGGACGTGCTTCTCGTCTT[T/A]GGCGAACGGCCGCTGTGCGAGTGAACTGTCTGGTCAGTACACCAAGATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Amyotrophic lateral sclerosis: Reduced expression of the Kinesin-Associated Protein 3 (KIFAP3) gene increases survival in sporadic amyotrophic lateral sclerosis. (View Study)
  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Height: A large-scale genome-wide association study of Asian populations uncovers genetic factors influencing eight quantitative traits. (View Study)
  • Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)
  • Height: Genome-wide association study of height and body mass index in Australian twin families. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3sxuljgs