ENSDARG00000088656

Ensembl ID:
ENSDARG00000088656

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20897 Nonsense Mutation detected in F1 DNA During 2014
sa17784 Essential Splice Site Available for shipment Available now
sa10190 Essential Splice Site Available for shipment Available now
sa8942 Nonsense Mutation detected in F1 DNA During 2014
sa20898 Nonsense Mutation detected in F1 DNA During 2014
sa20899 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123446 Nonsense 66 1729 2 26
Genomic Location:
Chromosome 7 (position 20591067)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATTCAGACCGTCATGATCTGGCAGAGATGCACATAGAGACACTCAGA[C/T]GATGTCAGGACACTGAGGGACCAAACTTTTTTGTAGGATTAATTCCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17784
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123446 Essential Splice Site 77 1729 3 26
Genomic Location:
Chromosome 7 (position 20591181)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RGTGACTTGAGTATATAATTTCAATATTTAAAGTCTTCCTTTTCTTGCAA[G/A]GTGKTCACWGGACAGAAGCATGAAATACTCTCGCTGCCAAATACTATTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10190
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123446 Essential Splice Site 414 1729 8 26
Genomic Location:
Chromosome 7 (position 20603211)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCNNNTTTTTTTGGCYAGGCAGTGTAAATATTCTTTCTTTTTTTCCACATT[A/C]GAGCACAGGGCTTTGCGTTCAGGCAGAACTTTCTAACAGAAGTAAGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123446 Nonsense 466 1729 8 26
Genomic Location:
Chromosome 7 (position 20603369)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGGAAAAAGCACGACGCTTGCCAAATTGGCTCAGCTAATACCTACTTG[G/A]ATAYCTGGGTAGGCAAACAAAACTATTAAAAATACACTGCCATTCAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123446 Nonsense 697 1729 11 26
Genomic Location:
Chromosome 7 (position 20607496)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTTGCTCATTTCACTGTCCCGCTCTGGCATCGCTGAGGAGGAACTTT[T/A]GGTGCTTTTAGGATGCGATGGTCATGTGAAGCGCGAGATGGCGAGTTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20899
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123446 Essential Splice Site 869 1729 12 26
Genomic Location:
Chromosome 7 (position 20609377)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAGTATATAAATACACAAGTGTGTGTGTTTGTTTGTGTGTGTTTTAC[A/T]GAGATCTTCTGGACGTTGCTGTTTTGGCTCAAGTTTTGAGTCTTTCTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ond8kadp