grn2

Ensembl ID:
ENSDARG00000088641
ZFIN ID:
ZDB-GENE-050522-264
Description:
granulin 2 [Source:RefSeq peptide;Acc:NP_997921]
Human Orthologue:
GRN
Human Description:
granulin [Source:HGNC Symbol;Acc:4601]
Mouse Orthologue:
Grn
Mouse Description:
granulin Gene [Source:MGI Symbol;Acc:MGI:95832]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13899 Essential Splice Site Available for shipment Available now
sa43332 Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13899
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051970 Essential Splice Site None 147 1 5
Genomic Location (Zv9):
Chromosome 19 (position 41159381)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40611919
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGACAGCAGCAGAAGCATCCCRAACAGAAGGAAAMCCAGCCAGAAAGG[T/G]AAATATTRCTATCACTCTCAGCAAATTTGCTTTGGGAAARGTAAACTATR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43332
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051970 Splice Site None 147 None 5
Genomic Location (Zv9):
Chromosome 19 (position 41157096)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40609634
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGTTTTGCTGCAAGACTGGAACTGGCCAGTGGGGCTGCTGCAGCGGT[A/T]AAACAGACTTCATATCACTGTATTAATAAGCATGGCTAATCAAGAAGCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link