cdca9

Ensembl ID:
ENSDARG00000088639
ZFIN ID:
ZDB-GENE-090706-4
Description:
Borealin-2 [Source:UniProtKB/Swiss-Prot;Acc:P86347]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17307 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17307
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123808 Essential Splice Site 44 255 1 10
Genomic Location:
Chromosome 12 (position 24023527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTCACCAAGAGAAAAGAGCTCTTCATACAACAGTTTGAGAAGGAAGG[T/C]CAGTCATTAAGCCAATACCSTTTTCCAGATTTTCTSTGGGTTCTTAAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e508tyjl