adcy1b

Ensembl ID:
ENSDARG00000088634
ZFIN ID:
ZDB-GENE-100805-1
Description:
adenylate cyclase type 1 [Source:RefSeq peptide;Acc:NP_001161822]
Human Orthologue:
ADCY1
Human Description:
adenylate cyclase 1 (brain) [Source:HGNC Symbol;Acc:232]
Mouse Orthologue:
Adcy1
Mouse Description:
adenylate cyclase 1 Gene [Source:MGI Symbol;Acc:MGI:99677]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6821 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19643 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6821
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131177 Essential Splice Site 233 834 5 17
Genomic Location:
Chromosome 2 (position 191726)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCTGAGATTCCCTTCTCTAACGTCATGAACTGTGAGGATGGGKACAAG[G/A]TATGACTTCAGCTGTCTGTGATTCTGTGTCAGTGACCGTCTGTGTGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19643
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131177 Essential Splice Site 233 834 5 17
Genomic Location:
Chromosome 2 (position 191725)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGAGATTCCCTTCTCTAACGTCATGAACTGTGAGGATGGGGACAAGG[T/C]ATGACTTCAGCTGTCTGTGATTCTGTGTCAGTGACCGTCTGTGTGTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bq9azq31