LOC799435

Ensembl ID:
ENSDARG00000088630
Human Orthologue:
ARHGEF10L
Human Description:
Rho guanine nucleotide exchange factor (GEF) 10-like [Source:HGNC Symbol;Acc:25540]
Mouse Orthologue:
Arhgef10l
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 10-like Gene [Source:MGI Symbol;Acc:MGI:1920004]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30949 Nonsense Mutation detected in F1 DNA During 2016
sa35105 Nonsense Mutation detected in F1 DNA During 2016
sa21933 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31839 Nonsense Mutation detected in F1 DNA During 2016
sa31838 Nonsense Mutation detected in F1 DNA During 2016
sa38849 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa30949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131165 Nonsense 172 1342 4 27
Genomic Location (Zv9):
Chromosome 11 (position 30413708)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29289694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGTTGTAATATGGCTGTATATTTGGGGAATGTTCCAGAGATCAAGCTT[C/A]AACAGACTCTACAGCACCAGAGGATTTAAATGAAGAGGAAGACCACACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131165 Nonsense 563 1342 14 27
Genomic Location (Zv9):
Chromosome 11 (position 30378249)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29254235
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGGACATGCTGAAGAACACTCCCACTGGCCATGTGGACAGACTGCCCT[T/A]GCAACTGGCTCTGACTGAATTGGAGACCCTCGCTGAGAAACTCAATGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131165 Essential Splice Site 605 1342 15 27
Genomic Location (Zv9):
Chromosome 11 (position 30368180)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29244166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTTGTAAGACTTGCGTGTAATCAGTGTGTCCCCTGTCTTTTTCTTCA[G/A]TTGCTCAACTCGGAGCAGAGCTCTTTGATCCTTTGTGAGACGCTGATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31839
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131165 Nonsense 783 1342 18 27
Genomic Location (Zv9):
Chromosome 11 (position 30348025)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29224011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCCGCATCAAAGAAGACCAAATTCAGAACGCCAACAAGTGCCGTTTA[C/T]GACTGCAAGTTCCTGGCAGACCAGACAAGTAAGTGAAGAGGAAACTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131165 Nonsense 924 1342 22 27
Genomic Location (Zv9):
Chromosome 11 (position 30266076)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29142062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACATCTTCTCCTTGAACAGACCCACACCTCGGCCTGTAAAATCCCTC[C/T]AGATGGGAGCTCAAGTGAGGTGTCTGGAGTATGTGCCTGAGCCCAGCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131165 Nonsense 1258 1342 27 27
Genomic Location (Zv9):
Chromosome 11 (position 30212397)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29088383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTACCGTCTACGCTCAACCTCAGGGTTACCCGGACGGCCATTAACCGCA[C/T]GAGGAGACGAAGCCTCAGACTCATCTCTAGAGTCTCTGGAGCACAGCATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link