ENSDARG00000088608

Ensembl ID:
ENSDARG00000088608
Human Orthologue:
L1TD1
Human Description:
LINE-1 type transposase domain containing 1 [Source:HGNC Symbol;Acc:25595]
Mouse Orthologue:
L1td1
Mouse Description:
LINE-1 type transposase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3578435]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22802 Nonsense Mutation detected in F1 DNA During 2014
sa7297 Nonsense Mutation detected in F1 DNA During 2014
sa14021 Nonsense Available for shipment Available now
sa13772 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22802
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122529 Nonsense 3 286 1 2
Genomic Location:
Chromosome 16 (position 20028205)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCATTTATCTCTCAACAGACTTATCAACCCCGTGCGATCTTCACAGGT[C/T]AGTCAAATAATCATAATAACAAACTTTTCGACATGAAACCGAGTTCGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7297
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122529 Nonsense 166 286 2 2
Genomic Location:
Chromosome 16 (position 20027701)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTAAGATTCRTTGGAGTCCCTGAAGGGGTTGAAGYGGGAAATCCGGTT[C/T]GATTCATCAAAGACCTGCTACTGGAGCTGTTTGGAGCTGACGAACTTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14021
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122529 Nonsense 286 286 2 2
ENSDART00000122529 Nonsense 286 286 2 2
Genomic Location:
Chromosome 16 (position 20027339)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WGTCTRTTTTACCCTGCCAGATTAACAATTACTGTGGACGGAATCAGGTA[C/A]ACTTTTGAGCACCCTCGAGAAGCTGATAMATTTCTGGAAAAGAAGTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122529 Nonsense 286 286 2 2
ENSDART00000122529 Nonsense 286 286 2 2
Genomic Location:
Chromosome 16 (position 20027339)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WGTCTRTTTTACCCTGCCAGATTAACAATTACTGTGGACGGAATCAGGTA[C/A]ACTTTTGAGCACCCTCGAGAAGCTGATAMATTTCTGGAAAAGAAGTCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rdlbp9jg