si:dkey-175m17.6

Ensembl ID:
ENSDARG00000088601
ZFIN ID:
ZDB-GENE-091204-392
Human Orthologue:
B3GNT2
Human Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 [Source:HGNC Symbol;Acc:15629]
Mouse Orthologue:
B3gnt2
Mouse Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:188950

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16734 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121590 Nonsense 44 441 1 1
ENSDART00000146588 Nonsense 44 441 2 2
Genomic Location (Zv9):
Chromosome 21 (position 26692543)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27261454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCATGGYGTCTGTATTTGTAGCTGTCTCCTACTCCCCTCCTGTACCA[C/T]AGCTGCCCCYTCATTTCATTGCCACCGGAGCCTCTGCARACTCAGGRGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link