CRISPLD2

Ensembl ID:
ENSDARG00000088595
Description:
cysteine-rich secretory protein LCCL domain containing 2 [Source:HGNC Symbol;Acc:25248]
Human Orthologue:
CRISPLD2
Human Description:
cysteine-rich secretory protein LCCL domain containing 2 [Source:HGNC Symbol;Acc:25248]
Mouse Orthologue:
Crispld2
Mouse Description:
cysteine-rich secretory protein LCCL domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1926142]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27098 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa21136 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa27098
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130227 Splice Site, Nonsense 345 512 9 14
Genomic Location (Zv9):
Chromosome 7 (position 70247863)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 68852506
KASP Assay ID:
2259-9789.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTTTATTCGTTAATCAATAAATTTTCTTTCTCCTTTTGTGTTTGCAG[C/T]AATCGAGTATTTGCCGTGCTGCTATTCACTATGGAGTAATTGATAACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21136
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130227 Essential Splice Site 388 512 9 14
Genomic Location (Zv9):
Chromosome 7 (position 70247995)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 68852638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCCCGTTCTTCGTAAAGGCAACCAAAAACGGCGTAGAGTCTTTCAGG[T/G]AATCAGAAAATAACCGTAAATTAGCAGTTATCTGTATTTTGTGATTCATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link