si:ch73-124n6.2

Ensembl ID:
ENSDARG00000088588
ZFIN ID:
ZDB-GENE-100922-285
Human Orthologue:
C1orf172
Human Description:
chromosome 1 open reading frame 172 [Source:HGNC Symbol;Acc:26624]
Mouse Orthologue:
1810019J16Rik
Mouse Description:
RIKEN cDNA 1810019J16 gene Gene [Source:MGI Symbol;Acc:MGI:1916323]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10657 Nonsense Available for shipment Available now
sa25093 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130559 Nonsense 180 334 1 3
ENSDART00000139792 Nonsense 180 334 2 4
Genomic Location (Zv9):
Chromosome 19 (position 30567554)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14254180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATACTGGAAGATGATTTAGTCAATGGTAATAAGATGGAAGATGTGGAT[C/T]AACTCATCACCCAGAAACTTATGGAGGTCTTCTCWGAGTTTGAGATCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130559 Essential Splice Site 308 334 2 3
ENSDART00000139792 Essential Splice Site 308 334 3 4
Genomic Location (Zv9):
Chromosome 19 (position 30570944)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14257570
KASP Assay ID:
554-7742.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGTCTGATGACATAGAAGCCAGGAAATTTCGCAACAACAGTAACCAGT[G/T]TAAGTATCAACTATTGATTTACCAAAAAAAAAAAAAAATGCAAATGAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link