psmd2

Ensembl ID:
ENSDARG00000088574
ZFIN ID:
ZDB-GENE-040426-1480
Description:
26S proteasome non-ATPase regulatory subunit 2 [Source:RefSeq peptide;Acc:NP_956840]
Human Orthologue:
PSMD2
Human Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 [Source:HGNC Symbol;Acc:9559]
Mouse Orthologue:
Psmd2
Mouse Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 Gene [Source:MGI Symbol;Acc:MGI:1096584]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32064 Nonsense Available for shipment Available now
sa14463 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32064
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126218 Nonsense 418 512 11 13
Genomic Location (Zv9):
Chromosome 15 (position 44372207)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149818.1 3041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATGCGCGTTTGGCAGCGATGCTCAGACAGCTGGCGCAGTACCACGCC[A/T]AAGACCCCAACAACCTCTTCATGGTCCGACTCGCACAGGTGAGCACAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126218 Nonsense 512 512 13 13
Genomic Location (Zv9):
Chromosome 15 (position 44370097)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149818.1 931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACGTTTGATGAGGAGCTCAGACCGCYACCGGTGTCCGYCCGGGTTGGA[C/T]AGGTGAGTGTTCATTGTGCAGACATGGGATATACTACTGGWGAAAYTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link