ENSDARG00000088572

Ensembl ID:
ENSDARG00000088572
Human Orthologues:
ZP1, ZP4
Human Descriptions:
zona pellucida glycoprotein 1 (sperm receptor) [Source:HGNC Symbol;Acc:13187]
zona pellucida glycoprotein 4 [Source:HGNC Symbol;Acc:15770]
Mouse Orthologue:
Zp1
Mouse Description:
zona pellucida glycoprotein 1 Gene [Source:MGI Symbol;Acc:MGI:103073]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4799 Nonsense F2 line generated During 2016
sa43250 Nonsense Mutation detected in F1 DNA During 2016
sa36808 Nonsense Mutation detected in F1 DNA During 2016
sa19214 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11286 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa4799
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122955 Nonsense 61 364 2 10
Genomic Location (Zv9):
Chromosome 19 (position 16848294)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTACTCTCTGACACAAGGCCATGACCATAATATTTTAGTTGTTGATTA[C/A]ACAGGCTGTCATGTCATCTTGGAGGTATTTTAGAATATATAAAACTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43250
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122955 Nonsense 157 364 4 10
Genomic Location (Zv9):
Chromosome 19 (position 16845856)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAATATATCTGCTGATCAAAGAGTCATGTGTAGCCTGTCTGATGTAACA[C/T]AAGATAAGTGTCTGACAAGAGGATGCTGTTTTGATGTGATAACCTCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36808
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122955 Nonsense 160 364 4 10
Genomic Location (Zv9):
Chromosome 19 (position 16845845)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGATCAAAGAGTCATGTGTAGCCTGTCTGATGTAACACAAGATAAGTG[T/A]CTGACAAGAGGATGCTGTTTTGATGTGATAACCTCAGTCTGCTATTATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122955 Essential Splice Site 237 364 5 10
ENSDART00000122955 Essential Splice Site 237 364 5 10
Genomic Location (Zv9):
Chromosome 19 (position 16845439)
KASP Assay ID:
2261-3132.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGCAATTTTTAAATTTTCTGTCACTGAGTGTGGGACACATTCTTTTG[T/A]AAGTATCCTGATGTCCAGGTGTCCCAAGTCTTGTACATTGATTCAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122955 Essential Splice Site 237 364 5 10
ENSDART00000122955 Essential Splice Site 237 364 5 10
Genomic Location (Zv9):
Chromosome 19 (position 16845439)
KASP Assay ID:
2261-3132.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGCAATTTTTAAATTTTCTGTCACTGAGTGTGGGACACATTCTTTTG[T/A]AAGTATCCTGATGTCCAGGTGTCCCAAGTCTTGTACATTGATTCAATAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link