si:ch211-203d17.1

Ensembl ID:
ENSDARG00000088567
ZFIN ID:
ZDB-GENE-100922-13
Human Orthologue:
VPS72
Human Description:
vacuolar protein sorting 72 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:11644]
Mouse Orthologue:
Vps72
Mouse Description:
vacuolar protein sorting 72 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1202305]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22869 Nonsense Available for shipment Available now
sa17450 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127323 Nonsense 64 335 2 5
Genomic Location (Zv9):
Chromosome 16 (position 31888214)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29707577
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGTTTGTGTAGGAGCCTGTTAAAGTGGTGCGTCAGAAACCTAAACAA[C/T]GAAAACTGGCTGAACTTCCCAGGAGGACGGACAAGACGAAGATTGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17450
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127323 Essential Splice Site 91 335 2 5
Genomic Location (Zv9):
Chromosome 16 (position 31888297)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29707660
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACGAAGATYGACAAATACAACCCACCCGAACTACAGGATGACAWCAG[T/A]AAGTGTGAGAGGATGTCACTTTGCATGTGCTGACWGCTGACGTCACATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link