LOC100329739

Ensembl ID:
ENSDARG00000088549
Human Orthologues:
CRY1, CRY2
Human Descriptions:
cryptochrome 1 (photolyase-like) [Source:HGNC Symbol;Acc:2384]
cryptochrome 2 (photolyase-like) [Source:HGNC Symbol;Acc:2385]
Mouse Orthologues:
Cry1, Cry2
Mouse Descriptions:
cryptochrome 1 (photolyase-like) Gene [Source:MGI Symbol;Acc:MGI:1270841]
cryptochrome 2 (photolyase-like) Gene [Source:MGI Symbol;Acc:MGI:1270859]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17003 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17003
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125725 Nonsense 58 813 1 8
Genomic Location:
Chromosome 18 (position 5123965)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACACCCGGAGACTCTTTCTGGACCTGATCAAACCCCTTTCATCMGAGTA[T/A]GAACATCTACACAGTCAGCTGACCTCAGTCTTTCTAGAGTACTTCTCTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/aehzh870