ENSDARG00000088522

Ensembl ID:
ENSDARG00000088522

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28235 Nonsense Mutation detected in F1 DNA During 2016
sa42331 Nonsense Mutation detected in F1 DNA During 2016
sa8797 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa28235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125580 Nonsense 59 787 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2446521)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2352059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACGGAGCTGCTGTTGGAAATATCGCGAAGGATTTGGGAATTGATCAC[A/T]GAACACTGAAGGATCGGGGATTTCGCATCGTGTCGACCTCAGGCGAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42331
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125580 Nonsense 126 787 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2446723)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2351857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTGCTTTACAAAACCCACTAGAGATCCACTATGTTACTGTGGAGATAT[T/A]GGATGTGAACGATCACAGTCCGCGATTTCCAGAGGACGAGAAGCGGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125580 Nonsense 207 787 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2446965)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2351615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAAATCCCTATTTTARTTTTGCACAAACCACTTGACCGAGAAGTGATG[A/T]AACACATTAAACTAATATTAACAGCTTCCGATGGGGGTAGACCTCCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link