ENSDARG00000088522

Ensembl ID:
ENSDARG00000088522

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28235 Nonsense Mutation detected in F1 DNA During 2015
sa8797 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa28235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125580 Nonsense 59 787 1 1
Genomic Location:
Chromosome 14 (position 2446521)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACGGAGCTGCTGTTGGAAATATCGCGAAGGATTTGGGAATTGATCAC[A/T]GAACACTGAAGGATCGGGGATTTCGCATCGTGTCGACCTCAGGCGAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125580 Nonsense 207 787 1 1
Genomic Location:
Chromosome 14 (position 2446965)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAAATCCCTATTTTARTTTTGCACAAACCACTTGACCGAGAAGTGATG[A/T]AACACATTAAACTAATATTAACAGCTTCCGATGGGGGTAGACCTCCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/781ev9iy