NP_001164692.1

Ensembl ID:
ENSDARG00000088515
Description:
hypothetical protein LOC797439 [Source:RefSeq peptide;Acc:NP_001164692]
Human Orthologue:
ST6GAL2
Human Description:
ST6 beta-galactosamide alpha-2,6-sialyltranferase 2 [Source:HGNC Symbol;Acc:10861]
Mouse Orthologue:
St6gal2
Mouse Description:
beta galactoside alpha 2,6 sialyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2445190]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9770 Nonsense Available for shipment Available now
sa20674 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9770
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126255 Nonsense 133 453 1 5
Genomic Location (Zv9):
Chromosome 6 (position 15370342)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15343574
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAAGAAGTCCAAGATAATYCCACCTGAAGATAATGATAGAGATKACTA[T/A]TTTTCCAAYCCCTGGTCGGTGGTCCGGGGTTTGTGGAAGGGRCATGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126255 Nonsense 205 453 1 5
Genomic Location (Zv9):
Chromosome 6 (position 15370128)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15343360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGTGTCAGATGAAAGAGCAAGCCCAGATCAGGACTCTGAATGGCACT[G/T]AGCAGCCTTTTGCCGATCTGGGATTTAAACAGCTGGTTTCTCCTCCACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link