LOC100004554

Ensembl ID:
ENSDARG00000088500
Human Orthologue:
C19orf12
Human Description:
chromosome 19 open reading frame 12 [Source:HGNC Symbol;Acc:25443]
Mouse Orthologue:
1600014C10Rik
Mouse Description:
RIKEN cDNA 1600014C10 gene Gene [Source:MGI Symbol;Acc:MGI:1919494]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6084 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129669 Nonsense 84 141 2 2
Genomic Location:
Chromosome 7 (position 47598500)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGCAAATTCCATCCTCTWCATCAGATCATCATGGAGATGCCTCCCCAA[C/T]AGAAGAACAAACTGTACTCTGAGGTCATGGCCGTGCTGGGCAATCTGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fbqjjlv5