si:dkey-11f4.4

Ensembl ID:
ENSDARG00000088486
ZFIN ID:
ZDB-GENE-070912-360
Human Orthologue:
BPIL2
Human Description:
bactericidal/permeability-increasing protein-like 2 [Source:HGNC Symbol;Acc:16503]
Mouse Orthologue:
Bpil2
Mouse Description:
bactericidal/permeability-increasing protein-like 2 Gene [Source:MGI Symbol;Acc:MGI:3026884]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12773 Essential Splice Site Available for shipment Available now
sa7167 Nonsense Mutation detected in F1 DNA During 2017
sa27302 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12773
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121749 Essential Splice Site 32 472 None 15
ENSDART00000134093   None 98 None 3
ENSDART00000138006 Essential Splice Site 32 197 None 6
Genomic Location (Zv9):
Chromosome 9 (position 140922)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 343588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATAATCCAGCATTCAAAGCTCTTCTGTCAGAGAAGGCTCTCACAGACTG[T/C]AAGTTTGCTKTATTTATTCAGTTAGAGGACACGTTTAGCTTTAATCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7167
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121749 Nonsense 117 472 4 15
ENSDART00000134093   None 98 None 3
ENSDART00000138006 Nonsense 117 197 4 6
Genomic Location (Zv9):
Chromosome 9 (position 136184)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 348326
KASP Assay ID:
554-4571.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATKAGTAATGCTYATGCCTGTTCTCTGACTGCAGCACMGACAGCGGCT[C/A]RTTTGATGTGGAGGKCTACAATATATACATCYGTGTGGTCCTGGGGGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121749 Nonsense 437 472 14 15
ENSDART00000134093   None 98 None 3
ENSDART00000138006   None 197 None 6
Genomic Location (Zv9):
Chromosome 9 (position 130901)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 353609
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCTTTGTGATTATCTTGTCTCAGCTCGTCTGAGGTCCGGCTTTCTCT[T/A]GCCCACGCTGCAGGGATTTAGCTTGAGTAACTCTCAACTGCTCATCAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link