CLPB

Ensembl ID:
ENSDARG00000088463
Description:
ClpB caseinolytic peptidase B homolog (E. coli) [Source:HGNC Symbol;Acc:30664]
Human Orthologue:
CLPB
Human Description:
ClpB caseinolytic peptidase B homolog (E. coli) [Source:HGNC Symbol;Acc:30664]
Mouse Orthologue:
Clpb
Mouse Description:
ClpB caseinolytic peptidase B homolog (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1100517]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32067 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128224 Nonsense 33 222 3 6
Genomic Location (Zv9):
Chromosome 15 (position 46398071)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 46918252
GRCz10 15 46944946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGCGTGCTGCAGGTGGCGAAGTTCATCGGGTCTCCTCCAGGTTA[T/A]GTTGGTCATGATGAGGGTGGTCAGCTCACCAAGCAGCTGAAGCAGAGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link