or111-7

Ensembl ID:
ENSDARG00000088453
ZFIN ID:
ZDB-GENE-000329-15
Description:
odorant receptor, family D, subfamily 111, member 7 [Source:RefSeq peptide;Acc:NP_571657]
Human Orthologues:
OR2AT4, OR6K2, OR6K3, OR6K6, OR6N1, OR6N2
Human Descriptions:
olfactory receptor, family 2, subfamily AT, member 4 [Source:HGNC Symbol;Acc:19620]
olfactory receptor, family 6, subfamily K, member 2 [Source:HGNC Symbol;Acc:15029]
olfactory receptor, family 6, subfamily K, member 3 [Source:HGNC Symbol;Acc:15030]
olfactory receptor, family 6, subfamily K, member 6 [Source:HGNC Symbol;Acc:15033]
olfactory receptor, family 6, subfamily N, member 1 [Source:HGNC Symbol;Acc:15034]
olfactory receptor, family 6, subfamily N, member 2 [Source:HGNC Symbol;Acc:15035]
Mouse Orthologues:
Olfr231, Olfr420, Olfr421, Olfr424, Olfr427, Olfr429, Olfr430, Olfr520, Olfr521
Mouse Descriptions:
olfactory receptor 231 Gene [Source:MGI Symbol;Acc:MGI:3030065]
olfactory receptor 420 Gene [Source:MGI Symbol;Acc:MGI:3030254]
olfactory receptor 421 Gene [Source:MGI Symbol;Acc:MGI:3030255]
olfactory receptor 424 Gene [Source:MGI Symbol;Acc:MGI:3030258]
olfactory receptor 427 Gene [Source:MGI Symbol;Acc:MGI:3030261]
olfactory receptor 429 Gene [Source:MGI Symbol;Acc:MGI:3030263]
olfactory receptor 430 Gene [Source:MGI Symbol;Acc:MGI:3030264]
olfactory receptor 520 Gene [Source:MGI Symbol;Acc:MGI:3030354]
olfactory receptor 521 Gene [Source:MGI Symbol;Acc:MGI:3030355]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39059 Nonsense Mutation detected in F1 DNA During 2017
sa35924 Nonsense Mutation detected in F1 DNA During 2017
sa2789 Nonsense F2 line generated During 2017
sa32048 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124360 Nonsense 42 325 1 1
Genomic Location (Zv9):
Chromosome 15 (position 30698563)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31520270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGTATACCTTACAGCAATTTGTACTATATTTTCATATTCATTATTTA[T/A]TTCATCACTGTAATTGGCAACTTTCTAGTCATTCTTCTTATAGTTCTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124360 Nonsense 73 325 1 1
Genomic Location (Zv9):
Chromosome 15 (position 30698471)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31520178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTCTTGACCGGAGTCTGCACAGTCCAAAGTACATTGGTGTGTTTAACT[T/A]GGCCTTGGCTGATATTGGTGAAACTAATGCTCTGATTCCTAACATGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2789
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124360 Nonsense 139 325 1 1
Genomic Location (Zv9):
Chromosome 15 (position 30698272)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31519979
KASP Assay ID:
554-2642.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTTATGGCGTATGATCGTTTAATTGCAATTTGCTTGCCATTAAGATA[T/A]CATGTCATTGTGAACAAYACCAGTATGATTTCAATTTTCTCAGCTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32048
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124360 Nonsense 177 325 1 1
Genomic Location (Zv9):
Chromosome 15 (position 30698160)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31519867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATTATTGTTGCCTCCATGGTGTCTTTGGTGACCAACATATCATTCTGT[A/T]AATCCAATGTGATACAGAGTTATTTTTGTGATCACGGACCAATGTTTAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link