LOC100333859

Ensembl ID:
ENSDARG00000088432
Human Orthologues:
MUC16, MUC20
Human Descriptions:
mucin 16, cell surface associated [Source:HGNC Symbol;Acc:15582]
mucin 20, cell surface associated [Source:HGNC Symbol;Acc:23282]
Mouse Orthologue:
Muc20
Mouse Description:
mucin 20 Gene [Source:MGI Symbol;Acc:MGI:2385039]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20842 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126123 Nonsense 1915 3161 7 17
Genomic Location:
Chromosome 7 (position 953145)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCAGTCAACAATGACCACATCACAACTTCCAACAGAAACAACCCAGT[C/A]AACAATCTCAACAAGTGCCCAGCCTACAAATACACCCCAGTCTGTAACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hqflm6oe