LOC100333859

Ensembl ID:
ENSDARG00000088432
Human Orthologues:
MUC16, MUC20
Human Descriptions:
mucin 16, cell surface associated [Source:HGNC Symbol;Acc:15582]
mucin 20, cell surface associated [Source:HGNC Symbol;Acc:23282]
Mouse Orthologue:
Muc20
Mouse Description:
mucin 20 Gene [Source:MGI Symbol;Acc:MGI:2385039]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20842 Nonsense Available for shipment Available now
sa33992 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38588 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20842
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126123 Nonsense 1915 3161 7 17
Genomic Location (Zv9):
Chromosome 7 (position 953145)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 835744
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCAGTCAACAATGACCACATCACAACTTCCAACAGAAACAACCCAGT[C/A]AACAATCTCAACAAGTGCCCAGCCTACAAATACACCCCAGTCTGTAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126123 Essential Splice Site 2951 3161 13 17
Genomic Location (Zv9):
Chromosome 7 (position 958781)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 841380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCACTTCCACATGCGCAGACTTTAACACAAACTTTGTGTTTTCTTTC[A/T]GAGCTGTGAACAAAATAAGGGCAGTAGAACAAAATGTACTGGTGGACCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38588
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126123 Essential Splice Site 3072 3161 16 17
Genomic Location (Zv9):
Chromosome 7 (position 959610)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 842209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTAACAGTCTGTTTTTATGACTAAATCTGGATTAAACACACTCTCTCT[A/C]GTGATGCCGGTGTGAAATCAAAGATTGTGCCGTCGATCAGGAACAGCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link