NP_001017557.1

Ensembl ID:
ENSDARG00000088424
Description:
septin-10 [Source:RefSeq peptide;Acc:NP_001017557]
Human Orthologues:
SEPT10, SEPT14
Human Descriptions:
septin 10 [Source:HGNC Symbol;Acc:14349]
septin 14 [Source:HGNC Symbol;Acc:33280]
Mouse Orthologues:
Sept10, Sept14
Mouse Descriptions:
septin 10 Gene [Source:MGI Symbol;Acc:MGI:1918110]
septin 14 Gene [Source:MGI Symbol;Acc:MGI:1921472]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34796 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34796
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007982 Nonsense 289 429 7 10
Genomic Location (Zv9):
Chromosome 9 (position 57618424)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGCTGCGTGAGATGCTGATCTGTGTGAACATGGAGGATCTGCGGGAA[C/T]AAACACACACACGCCACTACGAGCTCTACAGACGCTGCAAACTGGAGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link