LOC566040

Ensembl ID:
ENSDARG00000088411
Human Orthologue:
NOTUM
Human Description:
notum pectinacetylesterase homolog (Drosophila) [Source:HGNC Symbol;Acc:27106]
Mouse Orthologue:
Notum
Mouse Description:
notum pectinacetylesterase homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1924833]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20659 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127836 Essential Splice Site 201 495 5 11
Genomic Location:
Chromosome 6 (position 10870951)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGTGGCAACAAAGCAGCATCGAAACCCAAACAGGGAAAAGAAACAGG[T/C]ATGATTTTTTAGTCTCAAATGTTGTAACCAGTCTTTGATACCGAAATTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f8t4kd7b