LOC100000890

Ensembl ID:
ENSDARG00000088409
Human Orthologue:
DACT3
Human Description:
dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis) [Source:HGNC Symbol;Acc:30745]
Mouse Orthologue:
Dact3
Mouse Description:
dapper homolog 3, antagonist of beta-catenin (xenopus) Gene [Source:MGI Symbol;Acc:MGI:3654828]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23381 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128384 Nonsense 449 586 4 4
Genomic Location (Zv9):
Chromosome 18 (position 45222980)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46815823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTACACTGTTGGACGGGATATGGGCAGACATCATAGTGATGAATTTTA[C/A]CCGCCCAGTCAGCGACTCTGGTGCTCCTCGGCAGATCTCAGTCAAGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link