MBD1 (2 of 2)

Ensembl ID:
ENSDARG00000088407
Description:
methyl-CpG binding domain protein 1 [Source:HGNC Symbol;Acc:6916]
Human Orthologue:
MBD1
Human Description:
methyl-CpG binding domain protein 1 [Source:HGNC Symbol;Acc:6916]
Mouse Orthologue:
Mbd1
Mouse Description:
methyl-CpG binding domain protein 1 Gene [Source:MGI Symbol;Acc:MGI:1333811]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8306 Nonsense Mutation detected in F1 DNA During 2014
sa18157 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8306
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127933 Nonsense 200 482 5 8
Genomic Location:
Chromosome 8 (position 8419975)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCCAGGTCAGAAAACACGGGAAATGGAGTTACACTTTTAAGGAAGAT[G/T]AAGACGACGCGGCCTATGTTGAGGATGTGGTTGATGCCAACATTGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18157
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127933 Nonsense 287 482 7 8
Genomic Location:
Chromosome 8 (position 8423034)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTATGGGTGAGGTGATCGGCTCGGTGCCCATGRCGGRCGAGATGAGC[C/T]AGAATGGATTTCTTCAGATCGAGATGGTGAAAGTGGGATCAWCTCCATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zwz1rgi9