KIAA1462 (2 of 2)

Ensembl ID:
ENSDARG00000088405
Description:
KIAA1462 [Source:HGNC Symbol;Acc:29283]
Human Orthologue:
KIAA1462
Human Description:
KIAA1462 [Source:HGNC Symbol;Acc:29283]
Mouse Orthologue:
9430020K01Rik
Mouse Description:
RIKEN cDNA 9430020K01 gene Gene [Source:MGI Symbol;Acc:MGI:2685174]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19886 Nonsense Mutation detected in F1 DNA During 2014
sa13711 Nonsense Available for shipment Available now
sa25125 Nonsense Mutation detected in F1 DNA During 2014
sa17304 Nonsense Available for shipment Available now
sa25124 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124628 Nonsense 276 1548 1 2
Genomic Location:
Chromosome 2 (position 49466532)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCAAGTATCCCGCAGCCTTTCAGCCTAGGCCCCTGCAACCAATCATT[A/T]AAACAGAGAGAAATACAGACCAGCAGGCTAGAACTGACCGAGTTACTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13711
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124628 Nonsense 374 1548 1 2
Genomic Location:
Chromosome 2 (position 49466236)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCAGATACAGATAGACAGGTTCCCAGATCAGGTCAAGGCTGACAGATA[T/A]ACAGATAAACAAATTAAACCAGAAATCAAGWTAGAGAAAGTTCCTGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124628 Nonsense 686 1548 1 2
Genomic Location:
Chromosome 2 (position 49465301)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAGGGGCCCTTGGAGCTTCATCAGCTCCATCGGCTCCATCTGCTCCAT[C/A]AGTTCCATCTGTTCCACCAACTCCAGGAGCTCCACCAGCTTCAGGAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17304
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124628 Nonsense 1143 1548 1 2
Genomic Location:
Chromosome 2 (position 49463931)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACTCTGATTACAGGAGAGGGAACAGAAGAAGACCTTGATGAGTCAAAC[A/T]AGGTTGTAGGTGATAAAGACAKTTTTKCAAGTGAGTCAGTTGAGAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124628 Nonsense 1180 1548 1 2
Genomic Location:
Chromosome 2 (position 49463819)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGCCTCTGATATTAAGGACGATTCTGAAAGTGCTGGGCAGAAATGTT[T/A]AGAAGTAAAAGAAACAGAAGCAGAGCAAAAAGAGACACCTGAAAGCCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ptddbspc