si:ch211-260b17.6

Ensembl ID:
ENSDARG00000088402
ZFIN ID:
ZDB-GENE-070912-256
Human Orthologue:
C13orf18
Human Description:
chromosome 13 open reading frame 18 [Source:HGNC Symbol;Acc:20420]
Mouse Orthologue:
5031414D18Rik
Mouse Description:
RIKEN cDNA 5031414D18 gene Gene [Source:MGI Symbol;Acc:MGI:2685590]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34650 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41423 Nonsense Mutation detected in F1 DNA During 2017
sa34649 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34650
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122382 Essential Splice Site 61 277 2 7
ENSDART00000132160   None 249 None 2
ENSDART00000143479 Essential Splice Site 66 282 2 7
Genomic Location (Zv9):
Chromosome 9 (position 26120487)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25276273
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTTCTCAGCACTTCCTGTGTGCCGGTTGTGGTACTGAAATTGAGGCAA[G/A]TGAGTAATGAATCTGCTCCTAGTAAGAGTCCTGTAATTCAGAGATTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122382 Nonsense 267 277 7 7
ENSDART00000132160   None 249 None 2
ENSDART00000143479 Nonsense 272 282 7 7
Genomic Location (Zv9):
Chromosome 9 (position 26116540)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25272326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTTCATGTTTCCGCGATGAATCATGTCCCAAATGTGCCAGACTCCAG[A/T]AACGAAAGAAACTCCAAGAAGACATGAGTGTATGAGACATCCTACACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34649
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122382 Nonsense 268 277 7 7
ENSDART00000132160   None 249 None 2
ENSDART00000143479 Nonsense 273 282 7 7
Genomic Location (Zv9):
Chromosome 9 (position 26116537)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25272323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCATGTTTCCGCGATGAATCATGTCCCAAATGTGCCAGACTCCAGAAA[C/T]GAAAGAAACTCCAAGAAGACATGAGTGTATGAGACATCCTACACGTGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link