ENSDARG00000088397

Ensembl ID:
ENSDARG00000088397
Human Orthologue:
KCNQ1
Human Description:
potassium voltage-gated channel, KQT-like subfamily, member 1 [Source:HGNC Symbol;Acc:6294]
Mouse Orthologue:
Kcnq1
Mouse Description:
potassium voltage-gated channel, subfamily Q, member 1 Gene [Source:MGI Symbol;Acc:MGI:108083]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24586 Nonsense Mutation detected in F1 DNA During 2014
sa10719 Nonsense Available for shipment Available now
sa6787 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126521 Nonsense 45 211 2 6
Genomic Location:
Chromosome 25 (position 2338138)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATTGTGCTGGTGGTGTTTTTCGGGACTGAGTATGTGGTGCGGCTCTG[G/A]TCTGCAGGCTGCCGGAGCAAATATGTGGGCATTAAAGGCCGTCTGCGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10719
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126521 Nonsense 153 211 5 6
Genomic Location:
Chromosome 25 (position 2331477)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAWCGGGTTCCKKGGTCTGATCTTCTCATCGTATTTTGTGTATTTGGCT[G/T]AAAAAGATGCAGTAGATGAAGAAGGGAAGACAGGTTTCTCCAGCTATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6787
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126521 Essential Splice Site 176 211 5 6
Genomic Location:
Chromosome 25 (position 2331404)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGAAGACAGGTTTCTCCAGCTATGCTGATGCTCTGTGGTGGGGCGTGG[T/C]GAGTTTATTCTCCTAAAATAATAAAAAACATTGATTGTTGGAGTTTTATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Electrocardiographic traits: Several common variants modulate heart rate, PR interval and QRS duration. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Platelet aggregation: Genome-wide meta-analyses identifies seven loci associated with platelet aggregation in response to agonists. (View Study)
  • Protein quantitative trait loci: A genome-wide association study identifies protein quantitative trait loci (pQTLs). (View Study)
  • QT interval: Common variants at ten loci influence QT interval duration in the QTGEN Study. (View Study)
  • QT interval: Common variants at ten loci modulate the QT interval duration in the QTSCD Study. (View Study)
  • QT interval: Impact of ancestry and common genetic variants on QT interval in African Americans. (View Study)
  • Type 2 diabetes: A genome-wide association study confirms previously reported loci for type 2 diabetes in Han Chinese. (View Study)
  • Type 2 diabetes: A genome-wide association study identifies GRK5 and RASGRP1 as type 2 diabetes loci in Chinese Hans. (View Study)
  • Type 2 diabetes: A genome-wide association study identifies susceptibility variants for type 2 diabetes in Han Chinese. (View Study)
  • Type 2 diabetes: Confirmation of multiple risk Loci and genetic impacts by a genome-wide association study of type 2 diabetes in the Japanese population. (View Study)
  • Type 2 diabetes: Genome-wide association study of type 2 diabetes in a sample from Mexico City and a meta-analysis of a Mexican-American sample from Starr County, Texas. (View Study)
  • Type 2 diabetes: SNPs in KCNQ1 are associated with susceptibility to type 2 diabetes in East Asian and European populations. (View Study)
  • Type 2 diabetes: Twelve type 2 diabetes susceptibility loci identified through large-scale association analysis. (View Study)
  • Type 2 diabetes: Variants in KCNQ1 are associated with susceptibility to type 2 diabetes mellitus. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/snhuu7qw