zgc:77938

Ensembl ID:
ENSDARG00000088366
ZFIN ID:
ZDB-GENE-040426-1910
Description:
hypothetical protein LOC402939 [Source:RefSeq peptide;Acc:NP_991205]
Human Orthologues:
ADH1A, ADH1B, ADH4, ADH6, ADH7
Human Descriptions:
alcohol dehydrogenase 1A (class I), alpha polypeptide [Source:HGNC Symbol;Acc:249]
alcohol dehydrogenase 1B (class I), beta polypeptide [Source:HGNC Symbol;Acc:250]
alcohol dehydrogenase 4 (class II), pi polypeptide [Source:HGNC Symbol;Acc:252]
alcohol dehydrogenase 6 (class V) [Source:HGNC Symbol;Acc:255]
alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide [Source:HGNC Symbol;Acc:256]
Mouse Orthologues:
AC079845.1, Adh1, Adh4, Adh6a, Adh6b, Adh7
Mouse Descriptions:
alcohol dehydrogenase 1 (class I) Gene [Source:MGI Symbol;Acc:MGI:87921]
alcohol dehydrogenase 4 (class II), pi polypeptide Gene [Source:MGI Symbol;Acc:MGI:1349472]
alcohol dehydrogenase 6 (class V), pseudogene 1 (Adh6-ps1), non-coding RNA [Source:RefSeq DNA;Acc:NR
alcohol dehydrogenase 6A (class V) Gene [Source:MGI Symbol;Acc:MGI:1916367]
alcohol dehydrogenase 6B (class V) Gene [Source:MGI Symbol;Acc:MGI:2446626]
alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide Gene [Source:MGI Symbol;Acc:MGI:87926]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16867 Nonsense Available for shipment Available now
sa22521 Essential Splice Site Available for shipment Available now
sa35728 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16867
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105604 Nonsense 51 378 4 10

The following transcripts of ENSDARG00000088366 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 37123511)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35562838
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAATTGACCCGGGTCAGATGGTGGCATCTGGAATATGCCATACCGACT[G/A]GACTTTCCTACATGAAGTTGGYAAAACAATGAATCCACAGCCTTTTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105604 Essential Splice Site 90 378 4 10

The following transcripts of ENSDARG00000088366 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 37123631)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35562958
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCGGAGTGGTGGAGAGTGTTGGTCCAGGTGTCACAAAGATGGCCAAAG[G/A]TAAGCTAACTTTTTCATATTTAACATTGGAAAAAGTGAAATCTGAGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35728
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105604 Nonsense 125 378 6 10

The following transcripts of ENSDARG00000088366 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 37126234)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35565561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAAGTGATCAAATAGATTCCTTTTTATTTCCAAGGGAGAAAACTCAG[C/T]AATGCCTTCTTGCTGATGGCACCAGCAGGATTACCTGTAAGAATCAGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link