PRRT4

Ensembl ID:
ENSDARG00000088343
Description:
proline-rich transmembrane protein 4 [Source:HGNC Symbol;Acc:37280]
Human Orthologues:
PRRT3, PRRT4
Human Descriptions:
proline-rich transmembrane protein 3 [Source:HGNC Symbol;Acc:26591]
proline-rich transmembrane protein 4 [Source:HGNC Symbol;Acc:37280]
Mouse Orthologues:
Prrt3, Prrt4
Mouse Descriptions:
proline-rich transmembrane protein 3 Gene [Source:MGI Symbol;Acc:MGI:2444810]
proline-rich transmembrane protein 4 Gene [Source:MGI Symbol;Acc:MGI:2141677]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23235 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23235
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126331 Nonsense 69 866 1 3
Genomic Location (Zv9):
Chromosome 18 (position 8321057)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8898435
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCCTGATGTACATCCCAACAGAGACCTTTTGACTGAACCAAACCTTTA[T/A]ATCACAACAGCCTCAAAAACGCAGTGGATCAAAACTGTAGTTTCCAGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link