LOC557826

Ensembl ID:
ENSDARG00000088342
Human Orthologue:
TMEM145
Human Description:
transmembrane protein 145 [Source:HGNC Symbol;Acc:26912]
Mouse Orthologue:
Tmem145
Mouse Description:
transmembrane protein 145 Gene [Source:MGI Symbol;Acc:MGI:3607779]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18227 Essential Splice Site Available for shipment Available now
sa22850 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14299 Nonsense Available for shipment Available now
sa17531 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18227
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129081 Essential Splice Site 92 579 2 15
Genomic Location:
Chromosome 16 (position 28305421)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCCTGACCGATTTTGGCCGACTGAACTTTAGATTCCRATACCCCAAG[G/A]TAAGATTAAAGATTAAAGTTTGAATTAATGCCTATGACCTGATTACAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22850
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129081 Essential Splice Site 92 579 2 15
Genomic Location:
Chromosome 16 (position 28305420)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCTGACCGATTTTGGCCGACTGAACTTTAGATTCCGATACCCCAAGG[T/A]AAGATTAAAGATTAAAGTTTGAATTAATGCCTATGACCTGATTACAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14299
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129081 Nonsense 350 579 12 15
Genomic Location:
Chromosome 16 (position 28280517)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCACTGCGTGTGTGTGTTGTAGTTCTTTGATCCAGGCGAGGTGCTGTA[T/A]GCTTATGACAGCCYTGCAGGGTACGGTCTAATGGGTCTGCAGCTGCTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17531
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129081 Nonsense 386 579 12 15
Genomic Location:
Chromosome 16 (position 28280411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGGTTCTGCTATGCTGTGCTGGTGTCCCTCAAACACTACCCTGAAAAA[C/T]AGCCTTTCTACATCCCCTTCTTCACGGCRTACACTCTTTGGTGAGTTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9mc76uvr