ENSDARG00000088329

Ensembl ID:
ENSDARG00000088329

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35432 Nonsense Mutation detected in F1 DNA During 2016
sa11045 Nonsense Available for shipment Available now
sa38925 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124687 Nonsense 65 284 1 1
Genomic Location (Zv9):
Chromosome 13 (position 11293578)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 11445608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAGTTTACCTCATCAGCCTGCTCGCGTCTGACATCTTCAACATCCTC[G/T]GACGGCCCAAATCCTCAACGGGGGACGGCCAGCACATCAGCATGTCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124687 Nonsense 113 284 1 1
Genomic Location (Zv9):
Chromosome 13 (position 11293432)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 11445462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGTGTTYCTGGTCTGCGTGGCTCAGGAGAGATACCTGCTGGTGACCTG[T/A]CCCCAATATAACGCCTTCTGCGTCAAACTCAAGCAGTCCAGCATGATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124687 Nonsense 204 284 1 1
Genomic Location (Zv9):
Chromosome 13 (position 11293159)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 11445189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATTCTAGGTATGCAGGCGGTGATTTTGAGTAATTACACCATGCTTTA[T/A]CTGCCGTTTGTCCTCAATACGCTGCTCACCGCGTTGTCTCTAGGCTCTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link