ubap2

Ensembl ID:
ENSDARG00000088318
ZFIN ID:
ZDB-GENE-070424-16
Description:
ubiquitin-associated protein 2 [Source:RefSeq peptide;Acc:NP_001076307]
Human Orthologue:
UBAP2
Human Description:
ubiquitin associated protein 2 [Source:HGNC Symbol;Acc:14185]
Mouse Orthologue:
Ubap2
Mouse Description:
ubiquitin-associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:1916176]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23872 Nonsense Available for shipment Available now
sa43594 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23872
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092073 Nonsense 28 1169 1 27
ENSDART00000109292 Nonsense 27 1168 1 26
ENSDART00000136103 Nonsense 28 1169 2 27
Genomic Location:
Chromosome 21 (position 10347836)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGCACTCGGGACAAAGCGCTGCCCACTACCACACAGACCACACAACCA[C/T]AGAAACAGCTTCAGGTGAGTAAACAACATCATATGGAAGCGTATGCCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43594
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092073 Nonsense 550 1169 13 27
ENSDART00000109292 Nonsense 549 1168 13 26
ENSDART00000136103 Nonsense 550 1169 14 27
Genomic Location:
Chromosome 21 (position 10363911)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGCCCTGGACTTTGGTTCAGAATCTGCCCTGCCGGACTTCAGCCAAT[C/A]GGAGAACTGCAGCAGTGAACCCATAAGAGAGACTGCAGTAGTTTCTCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link