ubap2

Ensembl ID:
ENSDARG00000088318
ZFIN ID:
ZDB-GENE-070424-16
Description:
ubiquitin-associated protein 2 [Source:RefSeq peptide;Acc:NP_001076307]
Human Orthologue:
UBAP2
Human Description:
ubiquitin associated protein 2 [Source:HGNC Symbol;Acc:14185]
Mouse Orthologue:
Ubap2
Mouse Description:
ubiquitin-associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:1916176]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23872 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23872
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092073 Nonsense 28 1169 1 27
ENSDART00000109292 Nonsense 27 1168 1 26
ENSDART00000136103 Nonsense 28 1169 2 27
Genomic Location:
Chromosome 21 (position 10347836)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGCACTCGGGACAAAGCGCTGCCCACTACCACACAGACCACACAACCA[C/T]AGAAACAGCTTCAGGTGAGTAAACAACATCATATGGAAGCGTATGCCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/otzfjly4