ENSDARG00000088315

Ensembl ID:
ENSDARG00000088315
Human Orthologue:
ZPLD1
Human Description:
zona pellucida-like domain containing 1 [Source:HGNC Symbol;Acc:27022]
Mouse Orthologue:
Zpld1
Mouse Description:
zona pellucida like domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2443415]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14945 Essential Splice Site Available for shipment Available now
sa41683 Nonsense Mutation detected in F1 DNA During 2016
sa34927 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14945
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126340 Essential Splice Site 3 371 1 9
Genomic Location:
Chromosome 10 (position 29842615)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGATCTCACAGACTAAGGATWCCAAACCTGCARCAAGAATGAGACARG[G/A]TGCGTAGGATGTGTAACTACGGGACATTCKTTGAGCTGAGGATGTATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41683
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126340 Nonsense 259 371 7 9
Genomic Location:
Chromosome 10 (position 29837179)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGATGCTTCGCCTCCGTCTCTAACAAACCCGTCACCAAAACCTTCTA[T/A]GACCTCTTTTTGGCGTAAGTTCACTCTAAAAAGCCATTTAATTTATAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126340 Essential Splice Site 321 371 9 9
Genomic Location:
Chromosome 10 (position 29835325)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAACCCAGAGACACATATTGACTCACTGATGCTCAACGGCTCTTTCAC[A/T]GCAATGTCGCAAAAGAAAAAAGAGGGATGTTTCTCCAAGTGGAGTCACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link