ENSDARG00000088310

Ensembl ID:
ENSDARG00000088310
Human Orthologue:
MLLT4
Human Description:
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 [Sour
Mouse Orthologue:
Mllt4
Mouse Description:
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 Gene

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10884 Essential Splice Site Available for shipment Available now
sa13762 Nonsense Available for shipment Available now
sa15870 Nonsense Available for shipment Available now
sa16881 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10884
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124888 Essential Splice Site 89 962 4 20
Genomic Location:
Chromosome 17 (position 6082065)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGCACWTCTCAAGTTCTTAWCATGTGTATGYCATTCATTTCWGTTTTC[A/G]GATGAGGACTCTTTCTTGCTTTCTGTSATAAACGATATTAAMAGCTCCRC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13762
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124888 Nonsense 629 962 15 20
Genomic Location:
Chromosome 17 (position 6057674)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCAAACCCCAAACAAAACCAGGAGCTGCTCAAGAAGACGCTGGAGTA[T/G]CGCTCAAAYCCYAACCTGACATGTGAGTGWTTGGATTMTTTTGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15870
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124888 Nonsense 711 962 17 20
Genomic Location:
Chromosome 17 (position 6056085)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGAACCACTGAACAGCCTCTGCATATTGCTGCATTCTCCAGGGATCAG[C/T]AGAAGATCAACTTCATGGTATTTTGTGTGTCTGTTTTATTGCCCTGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124888 Nonsense 819 962 18 20
Genomic Location:
Chromosome 17 (position 6054768)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCAGCACCTTCCGCCRGCCTGCAGAYAGCAGAAYTACWTCCCAAACR[C/T]AGCATCTGKATCAATGCTTCGGTGCTTCAGCGTCTCAGAGCAAGGTATTW
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j4bz6jym