LOC793956

Ensembl ID:
ENSDARG00000088307
Human Orthologue:
MKL2
Human Description:
MKL/myocardin-like 2 [Source:HGNC Symbol;Acc:29819]
Mouse Orthologue:
Mkl2
Mouse Description:
MKL/myocardin-like 2 Gene [Source:MGI Symbol;Acc:MGI:3050795]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22081 Nonsense Mutation detected in F1 DNA During 2014
sa10017 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22081
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127655 Nonsense 416 986 10 15
Genomic Location:
Chromosome 12 (position 21125819)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACTAATAATGTGTTTATTTTGGCAGGTGGCAGAGCTGAAAATGGAGT[T/A]GAAGTTGCGTGGTCTTCCAGTATCAGGAACAAAAACTGACCTTATTGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10017
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127655 Nonsense 758 986 12 15
Genomic Location:
Chromosome 12 (position 21131073)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTAGCTCCCCAGAGAACAGAACCTCACCTCAGACGTCCCCCATCCCAT[C/A]ATCCCTTATCAATGGACAACTAAACAAGGTAGAACTTTTTGTTTTTATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Menarche (age at onset): Thirty new loci for age at menarche identified by a meta-analysis of genome-wide association studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ayulznxn