ENSDARG00000088302

Ensembl ID:
ENSDARG00000088302
Human Orthologues:
AP005117.2, FAM38B
Human Descriptions:
family with sequence similarity 38, member B [Source:HGNC Symbol;Acc:26270]
Transmembrane protein C18orf30 [Source:UniProtKB/Swiss-Prot;Acc:Q8N787]
Mouse Orthologue:
Fam38b
Mouse Description:
family with sequence similarity 38, member B Gene [Source:MGI Symbol;Acc:MGI:1918781]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5700 Essential Splice Site F2 line generated During 2014
sa3272 Essential Splice Site F2 line generated During 2014
sa24422 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa5700
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124243 Essential Splice Site 20 805 2 18
ENSDART00000124243 Essential Splice Site 20 805 2 18
Genomic Location:
Chromosome 24 (position 378276)
KASP Assay ID:
554-3159.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGTATATTAATATGTATGAAAACACTGGTCTGTTTGTCTTTCCTCAA[G/A]CCGGATAACTACACCGAGGCCCAGCGGATGGACATGGCYAAATCTCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3272
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124243 Essential Splice Site 20 805 2 18
ENSDART00000124243 Essential Splice Site 20 805 2 18
Genomic Location:
Chromosome 24 (position 378276)
KASP Assay ID:
554-3159.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGTATATTAATATGTATGAAAACACTGGTCTGTTTGTCTTTCCTCAA[G/A]CCGGATAACTACACCGAGGCCCAGCGGATGGACATGGCYAAATCTCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124243 Essential Splice Site 366 805 7 18
Genomic Location:
Chromosome 24 (position 383904)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCATCGCATACAACGTCTTCGTGATCACCATGAAGAACATCCTCTCGG[T/A]GAGTACAGGCTGTCTTTAAAACTCTTCAAATTAAACCTAGCCATATTGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rwn1eafk