DOC2B

Ensembl ID:
ENSDARG00000088293
Description:
double C2-like domains, beta [Source:HGNC Symbol;Acc:2986]
Human Orthologue:
DOC2B
Human Description:
double C2-like domains, beta [Source:HGNC Symbol;Acc:2986]
Mouse Orthologue:
Doc2b
Mouse Description:
double C2, beta Gene [Source:MGI Symbol;Acc:MGI:1100497]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33740 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33740
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128773 Nonsense 214 290 8 10
ENSDART00000131041 Nonsense 214 290 8 10
Genomic Location (Zv9):
Chromosome 5 (position 64387919)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60640579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTTTTTGTTCATGCTAATTCCGTTCTCTCTATCATAGGAGTTTTTCTA[T/A]GAAATCAAGTATGCTGACCTCAGCAAAAAGACCCTGGAGGTGACAGTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link