foxj1b

Ensembl ID:
ENSDARG00000088290
ZFIN IDs:
ZDB-GENE-041212-76, ZDB-GENE-041212-76
Description:
forkhead box J1b [Source:RefSeq peptide;Acc:NP_001008648]
Human Orthologue:
FOXJ1
Human Description:
forkhead box J1 [Source:HGNC Symbol;Acc:3816]
Mouse Orthologue:
Foxj1
Mouse Description:
forkhead box J1 Gene [Source:MGI Symbol;Acc:MGI:1347474]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22082 Nonsense Mutation detected in F1 DNA During 2014
sa9105 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125545 Nonsense 385 442 2 2
ENSDART00000126676 Nonsense 385 442 3 3
Genomic Location:
Chromosome 12 (position 21440526)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGATGCAACATGGAGGACTTCCACCACCAGCAGCACCACCAGCAAGCA[C/T]AGGTCCACCCGCAATATTACGAGGGGATGTTCTCGGATCAGCAGAATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125545 Nonsense 422 442 2 2
ENSDART00000126676 Nonsense 422 442 3 3
Genomic Location:
Chromosome 12 (position 21440639)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATTAAAGAGGAAGCCCAGCCAGTCCCTCTTTCGTTGGATCACGGCTA[T/A]GCGTTTTGTGAGGGATTCTTCTCAGAGATGCAACTTTGGGAAAGAGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/imgi2lyw