ENSDARG00000088283

Ensembl ID:
ENSDARG00000088283

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6035 Nonsense Mutation detected in F1 DNA During 2016
sa26095 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6035
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123600 Nonsense 11 704 1 1
Genomic Location (Zv9):
Chromosome 3 (position 32747404)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32478714
KASP Assay ID:
554-3704.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTCACAGAAGTCACGATGCAGATGACTTTACTGTCCATCACAGTGTG[G/A]TTCACTCACTTCCTCATCGTTTCAGCCTTCAATTTCAACACTCTGCCMAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123600 Nonsense 385 704 1 1
Genomic Location (Zv9):
Chromosome 3 (position 32746284)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32477594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCACAAAAGGATGAAAATAATCAAACAGGCATAAGTTATAATCATTTT[C/T]AAACTGTAGATCCATTCAGCAATGTCTCAACCCATCCCTGGAAGGAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link