LOC564784

Ensembl ID:
ENSDARG00000088277
Human Orthologue:
SUSD5
Human Description:
sushi domain containing 5 [Source:HGNC Symbol;Acc:29061]
Mouse Orthologue:
Susd5
Mouse Description:
sushi domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2685972]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15495 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15495
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123360 Nonsense 415 635 5 5
Genomic Location:
Chromosome 19 (position 44233134)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATGAGGAAGATAGCATCCACATTAAAGGAGATGAGGAACAGCTTACT[A/T]GACTCGAAGARGAGTCTGTTGGAATACATGAAGATACGACTGAAGGGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fmggzp2u