ENSDARG00000088261

Ensembl ID:
ENSDARG00000088261
Human Orthologue:
ATXN1
Human Description:
ataxin 1 [Source:HGNC Symbol;Acc:10548]
Mouse Orthologue:
Atxn1
Mouse Description:
ataxin 1 Gene [Source:MGI Symbol;Acc:MGI:104783]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37583 Nonsense Mutation detected in F1 DNA During 2016
sa15991 Nonsense Available for shipment Available now
sa24233 Nonsense Mutation detected in F1 DNA During 2016
sa37582 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129275 Nonsense 138 546 1 2
Genomic Location:
Chromosome 23 (position 676993)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATTAACATGCAGCCGCTCCTCTCCGTGCCCACATTCAAGAGTGTCTA[C/A]AGTGGGGATTCCAGGGAAATGTGGTCCTGTGGCCTCAGTCGGCCAGACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15991
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129275 Nonsense 167 546 1 2
Genomic Location:
Chromosome 23 (position 676908)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTCGGCCAGACTACAGCTCATCTCTGTTCTCCCCCCATGTCTTCCCA[C/T]AGCCTGCCGTTTATCYKCCCGACAGCSTCMCCGACAGCAGACTCAGGTRC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129275 Nonsense 340 546 1 2
Genomic Location:
Chromosome 23 (position 676387)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGGAGCTCCCAGAACCAACACAACAGCCATGGTGTAGAGACAGACTG[G/A]AGTTCTCCAGCAGGACCCTGCCGCCCTCCCCTTGCTGTGCTCATGGGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129275 Essential Splice Site 433 546 1 2
Genomic Location:
Chromosome 23 (position 676106)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACGGATTCAACCACTTGCAGGTCTTGCTCACAGACCGAAACACTCAGG[T/C]TAGTCCAGCTCAACACACATGCATACACAAATGAAACTACAGTCAACCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link