LOC570939

Ensembl ID:
ENSDARG00000088248
Human Orthologue:
RAB11FIP5
Human Description:
RAB11 family interacting protein 5 (class I) [Source:HGNC Symbol;Acc:24845]
Mouse Orthologue:
Rab11fip5
Mouse Description:
RAB11 family interacting protein 5 (class I) Gene [Source:MGI Symbol;Acc:MGI:1098586]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22537 Nonsense Mutation detected in F1 DNA During 2014
sa12871 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22537
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122870 Nonsense 141 1271 2 6
Genomic Location:
Chromosome 14 (position 48211144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATTTAAGGTGGCTCAAGCTGCACTCCAAGGCTGGCCGAAAGGAGAAA[G/T]AGCGAGGAGAGCTACAGGTCACCATCCAGTTCACCCGCAACAACATGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12871
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122870 Nonsense 216 1271 2 6
Genomic Location:
Chromosome 14 (position 48211371)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTGTCCGGGTCTGTGGGTCCACCGTTTGCTGGAGACGGTGGATCTTA[T/A]GAGGCGAGTGAAGAAGACGGRGTGGAAGAACACCGGAGTAAGGTCAAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6eo4l908