LOC570939

Ensembl ID:
ENSDARG00000088248
Human Orthologue:
RAB11FIP5
Human Description:
RAB11 family interacting protein 5 (class I) [Source:HGNC Symbol;Acc:24845]
Mouse Orthologue:
Rab11fip5
Mouse Description:
RAB11 family interacting protein 5 (class I) Gene [Source:MGI Symbol;Acc:MGI:1098586]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22537 Nonsense Available for shipment Available now
sa12871 Nonsense Available for shipment Available now
sa28363 Nonsense Mutation detected in F1 DNA During 2016
sa42446 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22537
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122870 Nonsense 141 1271 2 6
Genomic Location (Zv9):
Chromosome 14 (position 48211144)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46284016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATTTAAGGTGGCTCAAGCTGCACTCCAAGGCTGGCCGAAAGGAGAAA[G/T]AGCGAGGAGAGCTACAGGTCACCATCCAGTTCACCCGCAACAACATGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12871
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122870 Nonsense 216 1271 2 6
Genomic Location (Zv9):
Chromosome 14 (position 48211371)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46284243
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTGTCCGGGTCTGTGGGTCCACCGTTTGCTGGAGACGGTGGATCTTA[T/A]GAGGCGAGTGAAGAAGACGGRGTGGAAGAACACCGGAGTAAGGTCAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122870 Nonsense 890 1271 4 6
Genomic Location (Zv9):
Chromosome 14 (position 48224399)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46297271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTACTTCAGAGTTTGCTTTCATTGATTCTGAAAGTTCACCTTCGGAGT[T/A]GCAACCATTTGAAATTAAAAATGGATCCAAAGAGTGTTCAAATGTACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122870 Nonsense 932 1271 4 6
Genomic Location (Zv9):
Chromosome 14 (position 48224525)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46297397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTCACCAGGTATACCTGAGGATATATTGTCCAAAATGGCATCAGAAT[T/A]GGATATGTTTTCACCAAAGAACGCCCTTTGCTCTTCCCCTTATGAGAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link