KIAA1267 (1 of 2)

Ensembl ID:
ENSDARG00000088238
Description:
KIAA1267 [Source:HGNC Symbol;Acc:24565]
Human Orthologue:
KIAA1267
Human Description:
KIAA1267 [Source:HGNC Symbol;Acc:24565]
Mouse Orthologue:
1700081L11Rik
Mouse Description:
RIKEN cDNA 1700081L11 gene Gene [Source:MGI Symbol;Acc:MGI:1923969]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6884 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122782 Nonsense 26 368 2 9
Genomic Location (Zv9):
Chromosome 3 (position 22357157)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22013548
KASP Assay ID:
554-4917.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTACATATGCAACGTGTACTGAAGGGACACTGGCAGAATCGTCCTCTS[G/T]AGAAAATCAAGYCCATCAAGAAGATTTCGCTYAAGCACAAGTTGTGTTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link