LOC100333524

Ensembl ID:
ENSDARG00000088237
Human Orthologues:
B3GALNT1, B3GALT5
Human Descriptions:
beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) [Source:HGNC Symbol;Acc:918]
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 [Source:HGNC Symbol;Acc:920]
Mouse Orthologues:
B3galnt1, B3galt5
Mouse Descriptions:
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:213
UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1 Gene [Source:MGI Symbol;Acc:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44428 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44428
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125777   None 314 None 2
ENSDART00000127928 Nonsense 1 323 1 2
Genomic Location (Zv9):
Chromosome Zv9_NA872 (position 7385)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149715.1 7385
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCAATCTGGCAACCTGGGTTGAAAAAATCTTTGCAATATATTACATT[T/A]GCACTGTATAGCGAGTGTGGCGGGGCCGAGAGGCGTGAGCCTGCGAAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link