ENSDARG00000088233

Ensembl ID:
ENSDARG00000088233

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14113 Nonsense Available for shipment Available now
sa14569 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14113
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126675 Nonsense 189 565 2 2
Genomic Location:
Chromosome 13 (position 12369847)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGAGCCCCGTATAGCATCAGTCAACATTGARTCTGACTGGATTGCTTA[T/G]GACCATAAARCTYCTGTCAGTATGGTTTCCARTTGGATTGCTGACTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14569
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126675 Nonsense 477 565 2 2
Genomic Location:
Chromosome 13 (position 12370710)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCATTAAGCCTGYCTGTACTGCTGGGGCCCCKGATGCTGGACCCAGAT[T/A]GAGTCAGACTGAAGTGCTGACCCMCTTCGACWTCCAACTCCCACTGAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1pt60oa9