CELSR2

Ensembl ID:
ENSDARG00000088231
Description:
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
Human Orthologue:
CELSR2
Human Description:
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
Mouse Orthologue:
Celsr2
Mouse Description:
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15866 Nonsense Available for shipment Available now
sa24041 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19274 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15866
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003091 Nonsense 51 1222 1 2
Genomic Location:
Chromosome 22 (position 24222)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCGCACTGGCGTGTGGGCCGCGGCCCGTTCACACAAACTCACCTGAGC[A/T]AGGTACTCAGACTGGCCGCGCGCTCAAACTCTGGGCTGCTGAGCAGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003091 Essential Splice Site 998 1222 1 2
Genomic Location:
Chromosome 22 (position 21379)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGACAACAACAGACCCCTGGAGGCATCCATGAAGATCTCCGTCTCCGG[T/C]AAGAGTTTATTAAATTGTGTTAACGAATGTGTTCTTACAAAAATCAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19274
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003091 Nonsense 1007 1222 2 2
Genomic Location:
Chromosome 22 (position 12432)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTTCTGTGGTCTGCAGATGGTGTGCACTCGGTGTCGGCTCAGTG[T/A]CTGCTGCAGGTCACCGTCATCACGGATGAGATGCTCTCCAACAGCATCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mrmt7pvt