CELSR2

Ensembl ID:
ENSDARG00000088231
Description:
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
Human Orthologue:
CELSR2
Human Description:
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
Mouse Orthologue:
Celsr2
Mouse Description:
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15866 Nonsense Available for shipment Available now
sa43733 Nonsense Mutation detected in F1 DNA During 2016
sa24041 Essential Splice Site Available for shipment Available now
sa19274 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15866
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003091 Nonsense 51 1222 1 2
Genomic Location (Zv9):
Chromosome 22 (position 24222)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 94412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCGCACTGGCGTGTGGGCCGCGGCCCGTTCACACAAACTCACCTGAGC[A/T]AGGTACTCAGACTGGCCGCGCGCTCAAACTCTGGGCTGCTGAGCAGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43733
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003091 Nonsense 191 1222 1 2
Genomic Location (Zv9):
Chromosome 22 (position 23802)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 93992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCAGCGACACAAATGATCACGACCCTGCCTTTGAGCAACAGGACTAT[A/T]AAGAGAGCGTACGAGAAAACCTGGAGATCGGTTACGAGGTCCTGACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24041
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003091 Essential Splice Site 998 1222 1 2
Genomic Location (Zv9):
Chromosome 22 (position 21379)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 91569
KASP Assay ID:
2261-6144.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGACAACAACAGACCCCTGGAGGCATCCATGAAGATCTCCGTCTCCGG[T/C]AAGAGTTTATTAAATTGTGTTAACGAATGTGTTCTTACAAAAATCAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19274
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003091 Nonsense 1007 1222 2 2
Genomic Location (Zv9):
Chromosome 22 (position 12432)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 115698
KASP Assay ID:
2261-6143.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTTCTGTGGTCTGCAGATGGTGTGCACTCGGTGTCGGCTCAGTG[T/A]CTGCTGCAGGTCACCGTCATCACGGATGAGATGCTCTCCAACAGCATCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link