fam78a

Ensembl ID:
ENSDARG00000088222
ZFIN ID:
ZDB-GENE-080220-25
Description:
hypothetical protein LOC100002878 [Source:RefSeq peptide;Acc:NP_001107947]
Human Orthologue:
FAM78A
Human Description:
family with sequence similarity 78, member A [Source:HGNC Symbol;Acc:25465]
Mouse Orthologue:
Fam78a
Mouse Description:
family with sequence similarity 78, member A Gene [Source:MGI Symbol;Acc:MGI:2443569]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40613 Nonsense Mutation detected in F1 DNA During 2017
sa40612 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124587 Nonsense 70 262 1 2
Genomic Location (Zv9):
Chromosome 5 (position 75109044)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 71210286
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGTGCTGGTGCCGCCGGTTGCCGGCAAGGAGAGCTGGACGGTCGGCTG[G/A]ATCCAGGCGTGCAACCACATGGAGTTCTACAACAAATACGGATCCAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40612
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124587 Nonsense 97 262 2 2
Genomic Location (Zv9):
Chromosome 5 (position 75098382)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 71199624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTCATGCTTTATATCCCTGCAGGTCCAGCTGGGAGCTTCCAGACCTG[C/T]GAGATGGTAAAATCCAGGCCATCAGCGACTCCGACGGCGTCAACTACCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link